Glyma08g06640 - SoyBase

SoyBase Follow us on Twitter @SoyBaseDatabase
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma08g06640

Feature Type:	gene_model
Chromosome:	Gm08
Start:	4782627
stop:	4785276
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma08g06640

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT1G61720	AT	Annotation by Michelle Graham. TAIR10: NAD(P)-binding Rossmann-fold superfamily protein \| chr1:22791326-22792757 REVERSE LENGTH=340	SoyBase	E_val: 3.00E-140	ISS
GO:0009964	GO-bp	Annotation by Michelle Graham. GO Biological Process: negative regulation of flavonoid biosynthetic process	SoyBase	N/A	ISS
GO:0044237	GO-bp	Annotation by Michelle Graham. GO Biological Process: cellular metabolic process	SoyBase	N/A	ISS
GO:0009507	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: chloroplast	SoyBase	N/A	ISS
GO:0000166	GO-mf	Annotation by Michelle Graham. GO Molecular Function: nucleotide binding	SoyBase	N/A	ISS
GO:0003824	GO-mf	Annotation by Michelle Graham. GO Molecular Function: catalytic activity	SoyBase	N/A	ISS
GO:0016491	GO-mf	Annotation by Michelle Graham. GO Molecular Function: oxidoreductase activity	SoyBase	N/A	ISS
GO:0033729	GO-mf	Annotation by Michelle Graham. GO Molecular Function: anthocyanidin reductase activity	SoyBase	N/A	ISS
GO:0050662	GO-mf	Annotation by Michelle Graham. GO Molecular Function: coenzyme binding	SoyBase	N/A	ISS
KOG1502	KOG	Flavonol reductase/cinnamoyl-CoA reductase	JGI		ISS
PTHR10366	Panther	NAD DEPENDENT EPIMERASE/DEHYDRATASE	JGI		ISS
PTHR10366:SF9	Panther	NAD(P)H STEROID DEHYDROGENASE-RELATED	JGI		ISS
PF01370	PFAM	NAD dependent epimerase/dehydratase family	JGI		ISS
UniRef100_G9F9U3	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: Anthocyanidin reductase 2 n=1 Tax=Glycine max RepID=G9F9U3_SOYBN	SoyBase	E_val: 0	ISS
UniRef100_G9F9U3	UniRef	Annotation by Michelle Graham. Best UniRef hit: Anthocyanidin reductase 2 n=1 Tax=Glycine max RepID=G9F9U3_SOYBN	SoyBase	E_val: 0	ISS

Proteins Associated with Glyma08g06640

Locus	Gene Symbol	Protein Name
	ANR2	Anthocyanidin reductase 2

Expression Patterns of Glyma08g06640

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology


Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma08g06640 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.08g062100	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma08g06640

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma08g06640

Limit To All Plant Sequences

>Glyma08g06640.1   sequence type=CDS   gene model=Glyma08g06640   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGCCAATATCAAGCAAATCGGAAAGAAGCAGGCTTGTGTGATCGGTGGCAGTGGATTTATTGCTTCTTTGTTGATCAAGCAGTTGCTTCAGAAGGGTTATGCTGTTAATACCACTGTTAGAGATTTAGGTAGTATCAATAAAATAGCTCACCTTTTGGTACTGAAAAATCTGGGCGAATTGAAAATATTTAGAGCAGATTTGACAGTTGAAGGAGATTTTGAAGCCCCTATATCAGGCTGTGAACTTGTATTCCAATTTGCTACACCTATGAACTTTGGTTCTGAAGATCCTGAGAATGACATGATCAAGCCAGCAATCAGCGGCGTATTGAATGTGCTGAAAACATGTGCTCAAACGAAAGAAGTCAAACGAGTCATCTTGACATCTTCAACTGATGCTGTAACTATTAACCAACTCAATGGAAAAGGTCATGTTATGGATGAAAGCAATTGGACTGATGTGGAGTACTTGACCACTGCAAAGCCACATGGATGGGGATATCCTGCCTCCAAAACACTAGCAGAGAAGGCTGCATGGAAATTTGCTGAAGAAAATCACATTGATCTCATCACTGTGATACCTTCCCTCACTGCTGGTCCTTCTATCACTGCAGACATCCCATTCAGTGTTGTGTTGGCTGCGTCCCTAATGAAAGGGAATGATTTCTACATTAAGTCTTTGAGAGAGATGCAATTGCTGTCAGGTTCAATATCTATCACTCATGTTGAGGATATTTGCCGAGCACATATATTTGTGGCAGAGAAAGAATCAGCTTCTGGTCGATACATTGTCTGTGCTCACAATACTAGTGTTCCTGAGCTTGCAAAGTTTCTTAGCGAAAGATACCCTCGATATGAAATTCCAACTGAATTCCATGATATCCCCTCCAAGGCAAAGTTAGTCATCTCTTCAGAGAAGCTTATCAAAGAAGGGTTCAGTTTCAAGTATGGCATTGAAGAAATTATTAACCAGAGTGTGGAGTACTTAAGGAGTGAGGGGGCCCTGCTCAACTAA

Predicted protein sequences of Glyma08g06640

Limit To All Plant Sequences

>Glyma08g06640.1   sequence type=predicted peptide   gene model=Glyma08g06640   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MANIKQIGKKQACVIGGSGFIASLLIKQLLQKGYAVNTTVRDLGSINKIAHLLVLKNLGELKIFRADLTVEGDFEAPISGCELVFQFATPMNFGSEDPENDMIKPAISGVLNVLKTCAQTKEVKRVILTSSTDAVTINQLNGKGHVMDESNWTDVEYLTTAKPHGWGYPASKTLAEKAAWKFAEENHIDLITVIPSLTAGPSITADIPFSVVLAASLMKGNDFYIKSLREMQLLSGSISITHVEDICRAHIFVAEKESASGRYIVCAHNTSVPELAKFLSERYPRYEIPTEFHDIPSKAKLVISSEKLIKEGFSFKYGIEEIINQSVEYLRSEGALLN*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain